strip
 

Universal Primer

The primers are synthetic DNA molecules whose sequences are complementary to the region flanking the target region which we are trying to amplify. To design the correct primers, it is necessary to have a little bit knowledge about template DNA sequence, on either side of the region of DNA we wish to amplify.

Primers which are complementary to the nucleotide sequences that are very common in a particular set of DNA molecules and cloning vectors are called Universal primers. Thus, they can bind to a wide variety of DNA templates.

Primers used during Polymerase chain reaction for amplification of DNA under specific thermal cycling conditions. Primers annealed to the denatured DNA template to provide an initiation site for the elongation of the new DNA molecule. Primers are specific to a particular DNA nucleotide sequence or they can be “Universal.”

All Universal Oligonucleotides are provided RP-HPLC-purified and MALDI -TOF MS controlled.

Below universal Primers are available @ free of cost for your research study

Universal Primer

Primer Name   Sequence   Base

16s rRNA Primer

27F   AGAGTTTGATCMTGGCTCAG   20
1492R   TACGGYTACCTTGTTACGACTT   22
518F   CCAGCAGCCGCGGTAATACG   20
800R   TACCAGGGTATCTAATCC   18
785F   GGATTAGATACCCTGGTA   18
907R   CCGTCAATTCMTTTRAGTTT   20
337F   GACTCCTACGGGAGGCWGCAG   21
1100R   GGGTTGCGCTCGTTG   15

18s rRNA Primer

NS1   GTAGTCATATGCTTGTCTC   19
NS8   TCCGCAGGTTCACCTACGGA   20

5.8s rRNA / ITS Primer

ITS1   TCCGTAGGTGAACCTGCGG   19
ITS2   GCTGCGTTCTTCATCGATGC   20
ITS3   GCATCGATGAAGAACGCAGC   20
ITS4   TCCTCCGCTTATTGATATGC   20
ITS5   GGAAGTAAAAGTCGTAACAAGG   22

COI Primers

LCO1490   GGTCAACAAATCATAAAGATATTGG   25
HCO2198   TAAACTTCAGGGTGACCAAAAAATCA   26

LSU Primers

LR0R   ACCCGCTGAACTTAAGC   17
LR7   TACTACCACCAAGATCT   17

T7 Primers

T7   AATACGACTCACTATAG   17
T7terminator   GCTAGTTATTGCTCAGCGG   19
T7promoter   TAATACGACTCACTATAGGG   20

M13 Primers

M13F-pUC(-40)   GTTTTCCCAGTCACGAC   17
M13R-pUC(-40)   CAGGAAACAGCTATGAC   17
M13F   GTAAAACGACGGCCAGT   17
M13R   GCGGATAACAATTTCACACAGG   22

Other Universl Primers

Bluescript SK   CGCTCTAGAACTAGTGGATC   20
EBV-RP   GTGGTTTGTCCAAACTCATC   20
KAN2-FP   ACCTACAACAAAGCTCTCATCAACC   25
KAN2-RP   GCAATGTAACATCAGAGATTTTGAG   25
M13-FP   TGTAAAACGACGGCCAGT   18
pBacPAC-RP   GTCTGTAAATCAACAACGC   19
pBAD-FP   ATGCCATAGCATTTTTATCC   20
pDONOR-FP   TAACGCTAGCATGGATCTC   19
pEGFP_N   CCGTCCAGCTCGACCAG   17
pEGFP-FP   TTTAGTGAACCGTCAGATC   19
pEGFP-RP   AACAGCTCCTCGCCCTTG   18
pESP-RP   TCCAAAAGAAGTCGAGTGG   19
pET-24a   GGGTTATGCTAGTTATTGCTCAG   23
pET-RP   CTAGTTATTGCTCAGCGG   18
pMalE   TCAGACTGTCGATGAAGC   18
pREP-fwd   GCTCGATACAATAAACGCC   19
35S-A   AAGGGTCTTGCGAAGGATAG   20
35S-B   AGTGGAAAAGGAAGGTGGCT   20
AD Reverse   AGATGGTGCACGATGCACAG   20
CYC1 Reverse   GCGTGAATGTAAGCGTGAC   19
DsRed1-C   AGCTGGACATCACCTCCCACAACG   24
DsRed1-N   GTACTGGAACTGGGGGGACAG   21
EGFP-C   CATGGTCCTGCTGGAGTTCGTG   22
EGFP-N   CGTCGCCGTCCAGCTCGACCAG   22
GAL1 Forward   AATATACCTCTATACTTTAACGTC   24
U-19mer Primer   GTTTTCCCAGTCACGACGT   19
T7 EEV   ATGTCGTAATAACCCCGCCCCG   22
Bluescript KS   TCGAGGTCGACGGTATC   17
pFastBac Forward   GGATTATTCATACCGTCCCA   20
pFastBac Reverse   CAAATGTGGTATGGCTGATT   20
AOX1 Forward   GACTGGTTCCAATTGACAAGC   21
AOX1 Reverse   GCAAATGGCATTCTGACATCC   21
a-Factor   TACTATTGCCAGCATTGCTGC   21
STag 18mer Primer   GAACGCCAGCACATGGAC   18
MT Forward   CATCTCAGTGCAACTAAA   18
QE Promoter   CCGAAAAGTGCCACCTG   17
pRH Forward   CTGTCTCTATACTCCCCTATAG   22
pRH Reverse   CAAAATTCAATAGTTACTATCGC   23
SV40-pArev   CCTCTACAAATGTGGTATGG   20
SV40-Promoter   GCCCCTAACTCCGCCCATCC   20
pTrcHis Forward   GAGGTATATATTAATGTATCG   21
pJET1.2F   CGACTCACTATAGGGAGAGCGGC   23
pJET1.2R   AAGAACATCGATTTTCCATGGCAG   24
T3   ATTAACCCTCACTAAAG   17
SP6   ATTTAGGTGACACTATAG   18
pGEX5   GGCAAGCCACGTTTGGTG   18
pGEX3   GGAGCTGCATGTGTCAGAGG   20
BGH-R   TAGAAGGCACAGTCGAGG   18
CMV-F   CGCAAATGGGCGGTAGGCGTG   21
RVprimer3   CTAGCAAAATAGGCTGTCCC   20
RVprimer4   GACGATAGTCATGCCCCGCG   20
GLprimer1   TGTATCTTATGGTACTGTAACTG   23
GLprimer2   CTTTATGTTTTTGGCGTCTTCCA   23
pQE-F   CCCGAAAAGTGCCACCTG   18
pQE-R   GTTCTGAGGTCATTACTGG   19
Gal4AD   TACCACTACAATGGATG   17
pBAD-F   ATGCCATAGCATTTTTATCCA   21
pBAD-R   GATTTAATCTGTATCAGG   18
EGFP-CF   AGCACCCAGTCCGCCCTGAGC   21
EGFP-CR   CGTCCATGCCGAGAGTG   17
EGFP-NR   CGTCGCCGTCCAGCTC   16

Primer Requirements

Optimal Design : At least 18bp to 20bp long
Primer Tm : 55°C ~ 60°C
G-C content : 50-55%
Concentration : 10 pmol/ul
Volume : At least 6 µl per reaction

Templates and primers must be provided in DI water or 10mM Tris buffer, not in TE